Detecting Antibodies against Aleutian Mink Disease Virus

For detection Aleutian mink disease virus (AMDV) antibodies, an ELISA was 26 developed using the recombinant VP2332-452 protein as an antigen. Counter 27 immunoelectrophoresis (CIEP) was used as a reference test to compare the results of enzyme 28 linked immunosorbent assay (ELISA) and western blotting (WB), the specificity and sensitivity of 29 VP2332-452-ELISA was 97.9% and 97.3%, respectively, which were higher than those of WB. 30 Therefore, this VP2332-452-ELISA might be a preferable method for detecting antibodies against 31 AMDV. 32 33 Aleutian mink disease virus (AMDV), a member of the genus Amdovirus, subfamily 34 Parvovirinae, family Parvoviridae, is a single-stranded DNA virus with a genome length of 4.8 kb 35 (1, 2). The AMDV genome contains two major open reading frames (ORFs), a 5’ ORF encoding 36 the capsid proteins VP1 and VP2, and a 3’ ORF encoding the nonstructural proteins NS1 and NS2. 37 Identified strains varied in pathogenicity from nonpathogenic (AMDV-G) to highly pathogenic 38 (AMDV-Utah 1, AMDV-United, and AMDV-K) (3-5). 39 AMDV has been found in all mink breeding countries and causes the greatest financial loss 40 to farmers, including decreased production, loss of breeding animals, and low-quality fur (6). This 41 nonenveloped DNA virus is persistent in the environment and resistant to various physical and 42 chemical treatments. AMDV infection is normally persistent and fatal, and there is no effective 43 vaccine against the disease (7-9). Transmission of AMDV occurs horizontally by direct and 44 indirect contact and vertically from pregnant mink to kits. Currently, the most successful strategies 45 for eradicating AMD program are based on serological screening and culling of all 46 antibody-positive animals. 47 AMD diagnosis is primarily based on the clinical signs and detection of AMDV antibodies. 48 Counter immunoelectrophoresis (CIEP) has been used widely for routine detection of AMDV 49 antibodies (10). Concerning antibody detection, ELISA has the advantage of being easily 50 automated whereas the CIEP analysis is labor intensive with many manual tasks, requires 51 sophisticated instruments, and not suited for automation. Currently, ELISA based on the 52 baculovirus expressed whole VP2 protein has been developed, and it seems to be in good 53 agreement with CIEP analysis (11). However, this ELISA has the disadvantage of requiring 54 propagation and purification of large quantities of VP2 protein in eukaryotic baculovirus systems 55 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom and expensive processes. Compared to eukaryotic expression system, the propagation and 56 purification of the proteins are easier, and the cost is lower in Escherichia coli (E. coli) expression 57 system. E. coli-expressed protein-based ELISA tests have a high sensitivity and specificity 58 because of the high concentration of immunoreactive antigens and have been used widely for large 59 scale surveys (12-15). However, the cost-effective ELISA based on E. coil-expressed protein for 60 rapid detecting antibodies against AMDV has not been developed. Therefore, in present study, we 61 developed a rapid, cheap, and sensitive ELISA base on E. coil-expressed proteins for screening 62 antibodies against AMDV. 63 Bloom et al., (16) demonstrated that the antigenic regions or the most consistently 64 immunoreactive regions were pVP2e, pVP2f, and pVP2g (between amino acids (aa) 290 and 525), 65 which encompassed the analogs or surface loops 3 and 4 of canine parvovirus (CPV)(17, 18), 66 containing the linear epitopes located on the external surface of the AMDV virion capsid proteins. 67 These pVP2e, pVP2f, and pVP2g segments of capsid proteins of AMDV could be detected with 68 all sera of mink infected with different AMDVs (ADV-TR, ADV-Utah, or ADV-Pullman). 69 Moreover, Bloom et al., (19) identified one most important surface-exposed residues, 19 amino 70 acids peptide VP2428-446 on VP2 segment. To express central antigen fragments of VP2 protein, the 71 potential major hydrophilic region or antigenic peak on VP2 was calculated, which located in the 72 central region from amino acids 332 to 452 (data not shown) by using DNASTAR LASERGENE 73 software 99 (20). Primers VP2eF994: 5’TATGGATCCAGACTAGGTCACTTTTGGGGTG3’ 74 (underlined nucleotides represent the BamHI site) and VP2gR1633:5’TATCTGCAGTTAAG 75 CGTTGTTGTTCATGCTAGGT3’ (underlined nucleotides represent the PstI site) corresponding 76 to this region (between aa 332 and 452) were designed. The amplified PCR product was 77 sequenced, resulting in the expected size of 362 bp. The PCR product was cloned into the 78 BamHI-PstI sites of pMAL-c2x vector (New England Biolabs). The correct orientation of inserts 79 was confirmed by restriction analysis and nucleotide sequencing. The recombinant 80 pMAL-VP2332-452 plasmid were transfected into BL21 E. coli (pLysS, Invitrogen). The expressed 81 VP2332-452 fusion proteins in cell debris and supernatant were purified by using a HisPur Cobalt 82 Purification Kit (Thermo Scientific) (Qiagen, Valencia, CA, USA) and then analyzed by 83 SDS-PAGE and western blotting. Nitrocellulose membranes were probed with AMDV-positive 84 mink sera (diluted 1:100) and phosphatase-labeled goat anti-feline IgG conjugates (1:2000 85 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom dilution) (Thermo Scientific). SDS-PAGE showed the VP2332-452 fusion protein with an 86 approximate molecular mass of 64 kDa (Fig. 1A), which is consistent with expected size of fusion 87 protein (24.5 kDa protein VP2332-452 plus 40 kDa MBP tag). Western blotting showed that 88 AMDV-positive sera reacted specifically against a purified 64 kDa VP2332-452 fusion protein (Fig. 89 1B). No any protein belong to pMAL-c2x was detected in BL21 E. coli . 90 Thirty mink were immunized with purified inactivated wild-type Chinese AMDV strain Z in 91 complete Freund’s adjuvant and boosted twice with incomplete Freund’s adjuvant at 2-week 92 intervals (Approved by the Harbin Veterinary Research Institute Animal Center). Sera were 93 collected at 15 day after the final boost; Thirty immunized (n=30) and eight non-immunized 94 mink sera (n=8) were used as positive and negative control samples in ELISA, WB, and CIEP (21, 95 22). Sera against other known mink pathogens: mink viral enteritis virus, Canine distemper virus, 96 and Aujeszky Disease (Pseudorabies) virus were collected at the Harbin Veterinary Research 97 Institute. 357 clinical serum samples were collected from minks suffering from AMD at various 98 commercial farms since 2011. 99 CIEP was performed using Danad antigen (Kopenhagen Fur Breeders’ Association, Glostrup, 100 Denmark) by following the manufacturer’s instructions (21, 22). Briefly, Danad antigen was added 101 in opposing wells spaced 1 cm, and the gel run for 30 min in Gelmann buffer (50.5 mM 102 barbiturate, 40 mM Tris) at 4.5 V. A. Precipitate formation in the gel between the two wells 103 indicated positivity. 104 For ELISA procedures, 96-well ELISA plate (BIOFIL; Canada JET Biochemicals Inc.), 100 μl 105 of sample volumes, and PBS containing 0.05% Tween 20 and 5% skim milk as a dilution buffer 106 were used. To standardize the VP2332-452-ELISA, the AMDV-positive and -negative sera were 107 diluted from 1:50 to 1:6400, and the conjugate from 1:500 to 1:4000. To determine the optimal 108 concentration of protein, a checkerboard titration was carried out with different amounts of 109 VP2332-452 protein (ranging from 7000 to 0.7 ng/ml). By using the AMDV-positive or -negative 110 sera, we found the optimal dilution of the test sera to be 1:100. The optimum VP2332-452 protein 111 concentration was found to be 700 n g/ml. The optimal conjugate dilution was determined to be 112 1:2000. Thus, standardized VP2332-452-ELISA procedure is 100 μ l of 700 n g/ml purified 113 VP2332-452 protein coated onto the wells of a 96-well ELISA plate and incubated overnight at 4°C. 114 After washing twice with PBS-T (PBS containing 0.05% Tween 20), 1:100 diluted 115 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom AMDV-positive and -negative sera were added. 100 μ l of the 1:2000 diluted conjugate was 116 added after washing. Reactions were stopped by adding 3 M NaOH, and the plate was read on a 117 microplate reader (Bio-Rad, Japan) at 405 nm. 118 Using this standardized procedure, a good positive/negative (P/N) ratio was obtained by 119 dividing the positive and negative optical density (OD) values ( 2.1). AMDV-negative (n=8) and 120 -positive sera (n=30) were examined for the presence of specific antibodies in both the 121 VP2332-452-ELISA and CIEP tests. The average OD of the AMDV-negative sera in the 122 VP2332-452-ELISA were 0.30±0.024 (standard deviations [SD]). Cut-off value of the test was 123 determined as 0.372 calculating the arithmetic mean plus three standard deviation of OD values of 124 negative samples. The 1:100-diluted serum specimens with OD of <0.372 or ≥ 0.372 were 125 interpreted as negative or positive, respectively. According to this criterion, eight uninfected mink 126 se ra were negative and thirty AMDV-positive sera were positive in the VP2332-452-ELISA. 127 The detection threshold of the VP2332-452-ELISA compared to that of the CIEP test was 128 determined by using serial dilutions of the AMDV-positive sera. The sensitivity was a dilution of 129 1:3200 sera tested at 0.372 absorbance units for the VP2332-452-ELISA. The negative-control sera 130 showed no detectable VP2332-452-specific antibodies in ELISA. Antisera specific for other known 131 mink pathogens yielded <0.372 OD values, indicating that there was no cross-reactivity between 132 the antisera specific for other known mink pathogens and VP2332-452 protein in ELISA. 133 The sensitivity and specificity of the VP2332-452-ELISA were compared to those of the CIEP 134 test by using the 357 clinical serum samples (Table 1). The CIEP test determined that 261 and 96 135 samples were AMDV-positive and -negative, respectively. The VP2332-452-ELISA result showed 136 that 256 and 101 serum samples were VP2332-452-antibody positive and negative, respectively. 137 Together, 357 serum samples were judged to be 254 positive and 96 negative by both methods 138 (Table 1). Using the CIEP test as a reference, the specificity and sensitivity of the 139 VP2332-452-ELISA were calculated to be 97.9% and 97.3%, respectively. The concordance between 140 the two methods was 98.0%. 141 The western blotting procedure was also optimized for AMDV antibody detection, and the 142 results were compared with those of CIEP. Briefly, Approximately 1 μg purified VP2332-452 143 proteins were subjected to 10% SDS-PAGE and transferred to nitrocellulose membrane. The 144 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom membrane was incubated with AMDV-positive (n=30) or -negative (n=8) sera (diluted 1:100 in 145 PBS) followed by a secondary HRP-conjugated goat anti-feline antibody (Supplemental material 146 Figure S1). AMDV-positive sera (n=30) reacted specifically against a purified 64-kDa VP2332-452 147 fusion protein. No proteins were detected from AMDV-negative (n=8) sera. To compare with the 148 CIEP test, 350 clinical serum samples (that were in agreement for both the CIEP test and the 149 VP2332-452-ELISA) were analyzed by western blotting. Briefly, 1 μ g/ml VP2332-452 fusion 150 proteins transferred from polyacrylamid gel on nitrocellulose membrane was probed with 1:100 151 diluted 350 clinical sera as described for western blotting. The sensitivity and specificity of 152 western blotting were analyzed using the results of the CIEP as a reference test. The specificity 153 and sensitivity were found to be 86.4% and 91.7%, respectively. The results of the CIEP test and 154 the western blotting assays were in agreement for 316 samples (Table 2). However, 21 samples 155 which were found negative in western blotting were positive in CIEP, and 13 sera negative CIEP 156 were positive in the western blotting. The sensitivity and specificity of western blotting were 157 lesser than the VP2332-452-ELISA. 158 The aims of this study was to develop a cheap, simple, and sensitive methods to detect 159 antibodies against AMDV in mink using VP2332-452 protein, a core antigen of VP2 protein. VP2 160 protein peak antigen region was calculated, cloned, and expressed in an E. coli system. By using 161 the purified VP2332-452 protein as detecting antigen, clinical mink sera were tested by 162 VP2332-452-ELISA and western blotting. The results of VP2332-452-ELISA and western blotting 163 using the purified recombinant VP2332-452 protein were compared with the results of CIEP using a 164 commercial antigen. The results showed that the recombinant protein VP2332-452 has a good 165 antigenicity to detect AMDV-specific antibodies in ELISA and western blotting. Also, compared 166 to western blotting, the ELISA results were in better concordance with CIEP. 167 A preferred diagnostic technique requires simple steps, cost-effective, and automated system 168 for intensive surveillance and routine diagnosis of a disease. The VP2332-452-ELISA is such a 169 technique to fulfill such objectives and serves as an inexpensive source of reagents for clinical 170 surveillance of AMDV infection. 171 In conclusion, the VP2332-452-ELISA has advantages over the CIEP and western blotting, and 172 it can be used for the detection of antibodies against AMDV in mink. 173 Acknowledgments This work was supported by the Modern Agroindustry Technology Research 174 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom System (CARS-43-10). 175 REFERENCES 176 1. Bloom ME, Alexandersen S, Perryman S, Lechner D, Wolfinbarger JB. 1988. Nucleotide 177 sequence and genomic organization of Aleutian mink disease parvovirus (ADV): sequence 178 comparisons between a nonpathogenic and a pathogenic strain of ADV. J Virol 62:2903-2915. 179 2. Bloom ME, Berry BD, Wei W, Perryman S, Wolfinbarger JB. 1993. Characterization of 180 chimeric full-length molecular clones of Aleutian mink disease parvovirus (ADV): 181 identification of a determinant governing replication of ADV in cell culture. J Virol 67:5976182 5988. 183 3. Bloom ME, Race RE, Wolfinbarger JB. 1980. Characterization of Aleutian disease virus as 184 a parvovirus. J Virol 35:836–843. 185 4. Gottschalck E, Alexandersen S, Storgaard T, Bloom ME, Aasted B. 1994. Sequence 186 comparison of the non-structural genes of four different types of Aleutian mink disease 187 parvovirus indicates an unusual degree of variability. Arch. Virol. 138:213–231. 188 5. Hadlow WJ, Race RE, Kennedy RC. 1983. Comparative pathogenicity of four strains of 189 Aleutian disease virus for pastel and sapphire mink. Infect. Immun. 41:1016–1023. 190 6. Gorham JR,Henson JB, Crawford TB, Padgett GA. 1976. The epizootiology of Aleutian 191 disease, p. 135–158. In R. H. Kimberlain (ed.), Slow virus diseases of animals and man. 192 Frontiers of Biology, North-Holland Publishing Co., Amsterdam, The Netherlands. 193 7. Aasted B, Alexandersen S, Christensen J. 1998. Vaccination with Aleutian mink 194 disease parvovirus (AMDV) capsid proteins enhances disease, while vaccination with the 195 major non-structural protein causes partial protection from disease. Vaccine 16:1158–1165. 196 8. Castelruiz Y, Blixenkrone-Møller M, Aasted B. 2005. DNA vaccination with the Aleutian 197 mink disease virus NS1 gene confers partial protection against disease. Vaccine 23:1225-1231. 198 9. Porter DD, Larsen AE, Porter HG. 1972. The pathogenesis of Aleutian disease of mink. II. 199 Enhancement of tissue lesions following the administration of a killed virus vaccine or 200 passive antibody. J Immunol 109:1-7. 201 10. Cho HJ, Ingram DG.1972. Antigen and antibody in Aleutian disease in mink. I. 202 prepicitation reaction by agar-gel electrophoresis. J Immunol 108:555-557. 203 11. Knuuttila A, Aronen P, Saarinen A, Vapalahti O. 2009. Development and evaluation of an 204 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom enzyme-linked immunosorbent assay based on recombinant VP2 capsids for the detection of 205 antibodies to Aleutian mink disease virus. Clin Vac Immunol 16: 1360-1365. 206 12. Sevinc F, Cao S, Xuan X, Sevinc M, Ceylan O. 2015. Identification and Expression of 207 Babesia ovis Secreted Antigen 1 and Evaluation of Its Diagnostic Potential in an 208 Enzyme-Linked Immunosorbent Assay. Journal of Clinical Microbiology. J Clin Microbiol 209 53:1531-1536. 210 13. Van Dreumel AK, Michalski WP, McNabb LM, Shiell BJ, Singanallur NB, Peck GR. 211 2015. Pan-Serotype Diagnostic for Foot-and-Mouth Disease Using the Consensus Antigen 212 of Nonstructural Protein 3B. J Clin Microbiol 6: 1797--1805. 213 14. Chang PC, Chen KT, Shien JH, Shieh HK. 2002. Expression of infectious 214 laryngotracheitis virus glycoproteins in Escherichia coli and their application in 215 enzyme-linked immunosorbent assay. Avian Dis 46:570-580. 216 15. Jiao YJ, Zeng XY, Guo XL, Qi X, Zhang X, Shi ZY, Zhou MH, Bao CJ, Zhang WS, Xu 217 Y, Wang H. 2011. Preparation and Evaluation of Recombinant Severe Fever with 218 Thrombocytopenia Syndrome Virus Nucleocapsid Protein for Detection of Total Antibodies 219 in Human and Animal Sera by Double-Antigen Sandwich Enzyme-Linked Immunosorbent 220 Assay. J Clinical Microbio 50: 372-377. 221 16. Bloom ME, Martin DA, Oie KL, Huhtanen ME, Costello F olfinbarger JB, Hayess SF, 222 Agbandje-Mckenna M. 1997. Expression of Aleutian Mink Disease Parvovirus Capsid 223 Proteins in Defined Segments: Localization of Immunoreactive Sites and Neutralizing 224 Epitopes to Specific Regions. J Virol 71: 705-714. 225 17. Strassheim ML, Gruenberg A, Veijalainen PML, Sgro JY, Parrish CR. 1994. Two 226 dominant neutralizing antigenic determinants of canine parvovirus are found on the 227 threefold spike of the virus capsid. Virology 198:175–184. 228 18. Tsao J, Chapman MS, Agbandje M, Keller W, Smith K., Wu H, Luo M, Smith TJ, 229 Rossmann MG, Compans RW, Parrish CR. 1991. The three-dimensional structure of 230 canine parvovirus and its functional implications. Science 251:1456-1464. 231 19. Bloom ME, Best SM, Hayes SF, Wells RD, Wolfnbarger JB, Mckenna R, 232 Agbandje-Mckenna M. 2001. Identification of Aleutian Mink Disease Parvovirus Capsid 233 Sequences Mediating Antibody-Dependent Enhancement of Infection, Virus Neutralization, 234 on O cber 7, 2017 by gest ht://jcm .sm .rg/ D ow nladed fom and Immune Complex Formation. J Virology 75:11116-11127. 235 20. Cui XL, Nagesha HS, Holmesa IH. 2003. Mapping of conformational epitopes on capsid 236 protein VP2 of infectious bursal disease virus by fd-tet phage display. J Virological Meth 237 114:109-112. 238 21. Bloom ME, Race RE, Hadlow WJ, Chesebro B. 1975. Aleutian disease of mink: the 239 antibody response of sapphire and pastel mink to Aleutian disease virus. J Immunol 240 115:1034-1037. 241 22. Cho HJ, Ingram DG. 1972. Antigen and antibody in Aleutian disease in mink. I. 242 Precipitation reaction by agar-gel electrophoresis. J Immunol 108: 555-557. 243